Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10725F6
Clone ID IST10725F6
Vector VICTR76
Project tigm

Sequence tag IST10725F6HMF1
Sequence
AATGTAGGAATCGGTCAGCCATCAAAGATAAGGAGGAGACAAAAGCCCACACACTGCAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100406365..100406426 62
NO GENE  


Sequence tag IST10725F6HMR1
Sequence
CCTTCTAACTCCTATTTACTTTTTAGAGAACAAATACAGTTTTANATCTTTGAGATTCCAGTTTTAAGCTAATTTTCTTT
TACACATTTGTATGTATGTGTGTGTACAAGCCTGTGTGCATGTGGGTACATGTTATAGAGGCCGAAAGCTAACCTCAGGT
GCCATCCTCAGGAGCACCAGCCGCCTCTTTCCAGGGAGACAAGTTCTCTCATTGGTTTGGAGCTCATAATTGTGCTGCCA
ACACACCCCAGGTGTTTCGTCAGCTCANGGATTATAAAATTGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI36397

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100406076..100406361 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032475 (Nck1) NM_010878 non-catalytic region of tyrosine kinase adaptor protein 1 Gene [Source:MGI (curated);Acc:Nck1-001]

 
Come back to gene ENSMUSG00000032475


For any suggestions or comments, please send an email to unitrap@crg.es