Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14185C7
Clone ID IST14185C7
Vector VICTR74
Project tigm

Sequence tag IST14185C7HMR1
Sequence
GTACAAAGGATCTTGAAGCTATGTAAGCACGCTGTGGGTTATTGGAGTCCTCTGGCATCGGAGGTAATGCTGAGCATGCG
CAGTACTAATANCCCAGGGCCTTTTTTTTTTNAAAACCGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30691173..30691291 113
NO GENE  


Sequence tag IST14185C7HMF1
Sequence
GTACACAATTCCTTAGGAGGATCGATTAACATAGTCGTGCCCAGAGATGCCGCGTAGGCCGCCATCTTTCAAATTTACGC
ATTCCGTACAGCAGAGGAATAGCTATCCAGCCAGATTACACGGAATGAGATAAAGAACGTAGACCCAAGCACTGTGGCCC
ACGTCCGAGCATCATCCGATAAGAGGAGGTTCTTCTGGACACGGGGTCATGAGTTCTGTAACACTGAGAAACCTAGTTGC
CACTCTGAATAACCTGCTCTCTGTGGAAGAAACCATGCGGTGCAGGGGATTCAGAGGAGAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI15003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30691288..30691594 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]

 
Come back to gene ENSMUSG00000058402


For any suggestions or comments, please send an email to unitrap@crg.es