Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14521F9
Clone ID IST14521F9
Vector VICTR74
Project tigm

Sequence tag IST14521F9BBF1
Sequence
AAGACTATAATAAAAAAAAATTAANAAATTACAGGTCAATACTCATCCTGTGTATTCTGTTTCTCCTCTTTGCCAATAAA
ACAAAATANATTAAAAATGGCAAAAACCTGGTCAATTGGACATAAAGGCTGTCTAAGGAATGGGAAGCATTTTTTACCCA
AATTCACATATTATAGTGGCCTAATATACAAAATATATAACAACCTCAAGAAACTAGACTATCCAAAGCAAAAAGTTCCA
ATTATAATGTGGTATAGATGTAAACAGAGAATTCTCAACAGANGAGTCTCAAAAAGCTGAGAAATACCTAATGAAATCAT
CGCCATCTTANCCATGAGGGGAATGCAAATCAAAATTACTTTGAGCATCTATCTTGTACATGTCANANGGNTTGAGATCA
ATAATACAAGTGACAGCTCATGCTGGCAAGAANGTGGNNAAAGGGNAACAAACCCCCAGCTCCTTGTGGGGNACNAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811260..121811733 450
NO GENE  


Sequence tag IST14521F9HMF1
Sequence
AAGACTATAATAAAAAAAAATTAANAAATTACAGGTCAATACTCATCCTGTGTATTCTGTTTCTCCTCTTTGCCAATAAA
ACAAAATANATTAAAAATGGCAAAAACCTGGTCAATTGGACATAAAGGCTGTCTAAGGAATGGGAAGCATTTTTTACCCA
AATTCACATATTATAGTGGCCTAATATACAAAATATATAACAACCTCAAGAAACTAGACTATCCAAAGCAAAAAGTTCCA
ATTATAATGTGGTATANATGTAAACAGAGAATTCTCAACAGANGAGTCTCAAAAAGCTGANAAATACCTAATGAAATCAT
CGCCATCTTANCCNTGANGGGAATGCNNATCAAAATTACTTTGAGCATCTATCTTGTACATGTCANANNGGTTGAGATCN
ATAATACAANTGACAGCTCATGCTGGCAAGAATGTNGANAAAGGGAAACAAACCCCCAGCTCCNTGTGGGGNANNAACNA
ANACCATCACTATNGAAATNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14521F9HMR1
Sequence
GTCTTGTACTTNATTTTAAAAAGATTTATACGTCTATCTGTCTTTTGCTTTCTCTTTATTTGTGGTGCTATCTACATTGT
GTGATGTTATTCACTATAATCTAATTATATTGTTTCTCTGGAAAATAGTANACCTTTACCTATTTTTGTCTTCTGAAAAT
TTACTATGAGTTTCTTGAGTTTTTGATAGTTGGGAAACAGTTTTAGTTTCCTCTTCTTGATCCTGAAGGCTTTCCTCTCC
TCATTTTTGGCAATTCTGTTTTCCAGTTGATGCAATCANCAATTTTTGGGGTTTTGCTACTTAANTGATTGATATGGTTA
ATACATTANGTTTGGCTTTTTAAACCTTTCTGATATATTATTGTCTGTGTGTCCN
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121810891..121811264 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es