Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13897G1
Clone ID IST13897G1
Vector VICTR74
Project tigm

Sequence tag IST13897G1BBF1
Sequence
AAGGCTTCAAAGGATCCTGACATACACAGAAACCTCAGGCCGGGGCCATTTGTCTATTTCTTTTCTTGCTGGCAAGGTAA
GTGAGGGTANACACACCTTTGATACAGGCCTTTTATTATACATGAGGGATTTTAATACTTATACCTTTCTCTAAGGAAAA
CTGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 34169913..34170075 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061751 (Kalrn) kalirin, RhoGEF kinase Gene [Source:MGI (curated);Acc:Kalrn-011]


Sequence tag IST13897G1HMF2
Sequence
GCAACATTGGTTTATTTATTTACTTGTTTTATGAGTGTGCCTGGCANAGCAGCATGTGGCGGTCAGAAGATAACTTTTGG
GAGTCATTTTTCTTCTTCCTCAACCCCAGGAACTGAACTCAGGTCCTCAGGCTTGGCAGCAAGCGCCTATACCTGATCTT
GCCGTCCTGACACTGACATTGAATTTATAATTACGTANAAAACTGTGTTTATATTTTAGGTACTTTTCTCCATTTGTATT
TCTGCTAGCAGTAAAAACTTTTTCTAATTTTTTTGATATAATGAAAGTTTCTTATAGAAAAATTAAAAAGTATAAAACCN
CTTTTACAGCAAACAAAAGTCACAATTCCNTACTGTAGAGAATAAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI13711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45600475..45600844 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es