Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046D11
Clone ID IST10046D11
Vector VICTR75
Project tigm

Sequence tag IST10046D11HMR1
Sequence
GTGGAGATATACAAAGTGTGATTACATTGCTTGACTCTATAGACATCAAACATGCAAGTGCTGCTGGCATAATCCCAGCA
ATCAGAACACTGTGACAGGTGTATTAGTCTTCATTTGAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147021226..147021341 108
NO GENE  


Sequence tag IST10046D11BBF1
Sequence
GGGTCACTGCAGGGAGCAGGAGACCTCTTCACTTTGATAAAGTCTGGCTTTCCTTCCCTGGTACCAGCATCCGCCTGTGG
GTGCAGCATGAGGGCAAACCGAACCAAGATGCCCTGCCCCAACCCCTCAGCAACAAACCCTGTCTCTGCTGGCCCAGGGT
TAGACCCACACCTGCATTTTCGGCAGCTCCTCCTCCACCAGCCGCTTCAACGCCTGCTTCTCTTCAGGTTCAAGATGATC
CCGACCCACGTGAATCAAAAATTTCTGTCGCACGATGGCGTGCGTAACCGAGCTACAGAGACACGTGTCATGACAGAGTT
CCAGCCTAACCCCTCCCCTTCACAACCCAGACTCTAATACCCAGACTCTATGCACCTGAGGTCCGGGCAAGCTCGAAAGA
AGCTGCGAGTGAATTTTCGCATCTCATCTCCCGGCGCCATTTTGCGTCACCAGGGATTGGTTGCTCCCGCCTTTTTTTCT
TCAAGGCTGGTTTCCCGAGCGACAGTAGTTTGCGCACGCGCAGTGCGGCGGCTTCGTGAGGAATGGGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134005857..134006405 549
 
EST/CDNA Est Name
  CF726957.1


Sequence tag IST10046D11BBR1
Sequence
ACCCAAAGAAGAAAAGGTTCCGCTTTAATTCAGAGTCAGGTTAGTGCCTTCTTCCCTGTTTATCTGTCTGTGACTCCAGC
ATCATTGGTTTCTTCAAAAGGCGAGGCGCATGTATTAATTGCAAGGCTGGGGCTTGGGGGACAGTGAGTCAGGAACCAGC
TGGGGCCACAGCTGTGGTGCTTCTTGCTGCCCTTCACTCTTAACCAGAGTAGATCC
Sequence Type genomic DNA
Unitrap ID UNI35529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134006402..134006616 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042606 (Hirip3) NM_172746 HIRA interacting protein 3 Gene [Source:MGI (curated);Acc:Hirip3-001]

 
Come back to gene ENSMUSG00000042606


For any suggestions or comments, please send an email to unitrap@crg.es