Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14821D3
Clone ID IST14821D3
Vector VICTR76
Project tigm

Sequence tag IST14821D3BBF1
Sequence
ACTGTGGCTCAGTTCATGTGGATCATCAGGAAAAGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI19271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466477..114466516 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23624280..23624319 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061468 (AC118010.11)  


Sequence tag IST14821D3HMR1
Sequence
CAGTGATGTCCGAGGGGACCAAGTACTTCCTCTTGTCTATGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466438..114466480 43
NO GENE  


Sequence tag IST14821D3HMF2
Sequence
ACTGTGGCTCAGTTCATGTGGATCATCAGGAAAAGGATCCAGCTTCCCTCCGAGAAGGCCATCTTCCTGTTTGTGGACAA
GACAGTCCCACAGTCCAGGTAAGAAGTGTTTGCTAGCTGGGCCTGTGGCTTGGAAATCCATTCGCCGCTTATAAAACTCA
AACCATAGGAGGTGTTCTTAGTACAACTTCTTCCTTTCCTTTTCCTTCCTTCCTTCCTTCTTTCCTTCCCTCCCTCCCTC
CCTCCCTTCCTCTCTTTCCCTATCCCTCCCTCTTTCTCTCTTTTGGTTTTTCAAGATAGTTTATTTCCTCCTTTTTTTAA
TTANATATTTTCTTTATTTACATTTCAAATGTTATCCGGAAAGTTCCTTATACCTCCCCCCATGCCCTGCTCCCCTACCC
ACCCACTCACACTTCTTGGCNCNNNCGTTCCCNTGTACTGAGGCATANAAAGTTNGCNAGANCNANGGGCNNCN
Sequence Type genomic DNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466477..114466946 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es