Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10164D11
Clone ID IST10164D11
Vector VICTR76
Project tigm

Sequence tag IST10164D11HMF1
Sequence
GGACCNATCACATAAAGTAGGAGCTCACATCAACATCAATTTGGGCAATTGGACTAAATCTTGCTTTTGGTCTGTGCAAT
GCACTGTACTGGGTATGTGGGGGGACAGAGATCGATCAGATGGTACCCAGAACCACCTGATTGAGTCTGTTTGCCCTTCA
GGGTTTGCTGTGTAACCATCCAGGTGAGAGGAGTGCGTCCTAGGGAGAGCACTGGTTATACAGATGAGCTCCAGTCTACA
AACACGCTGGTGCTGTCAGCTCATTTCCGATGAGAAGCAGTGTTTGCATGTTTGGATGACGCATCATTTCACCAGGGACC
ACAGAAGTGCACAGCAATGCCNGCTCGGGAGAGTAAGATGCACTCACCTGTCTCGGTGTCCCAGANTTNAAGGTACCTGT
CGTAGGCCGNACTGANGAACTGGGTTCCTGCAGTGTTGAAGCAGATGTCTCTCACAGCTTTACTGTGACCTGNNNGTGAA
GCCNGAAGCTGAGNTGAGAGANANGAGGAGCTGCAGCACANGGGAANCTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40562481..40563009 499
 
EST/CDNA Est Name
  BE333699.1 - DY248474.1 - AA656639.1


Sequence tag IST10164D11BBF1
Sequence
CTGAGTGCCTGATGATTTGGCTGCCCTCTTTCTAAATACTTTTTTTTTATTGATTCTATGTATTTTTACTAAAGAAAGGA
TTATATATTTGTTTGTAAAACTTANCAACAGTCAGATATCTTTAAGATTAAGTGTTGGGCCGGGTGGTGGTGGCCCATGC
CTTTAATCCCAGCACTTGGGAGGCAGAGGAAGGAGGATTTCTGAGTTTGAGGCCNGCCTGGTCTACAAAGTGAGTGCCAG
GACAGCCAGGGCNACNCANANAAACCCTGTCTNNAAAAACCAAAAAAAAAAAAAAAAANNTTT
Sequence Type genomic DNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15126058..15126355 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es