Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14751D7
Clone ID IST14751D7
Vector VICTR76
Project tigm

Sequence tag IST14751D7HMR1
Sequence
GTGCTCAGCGTCAGTTNAGTTGCTCACAGCTTCTCACAGCGCATGTTTGACTGTAGTCTGTAAATAGAGGTCAGTTTCTG
TGCTGGTAACAGGTATTGCACAGACATGATTTCAGGTAAATAAATCTATTCTACGATAAACCCTCAGCAGAGCTGTGGCT
GATTTACAGGAGGGTGGGGACGGGCACTGANGCCTCCCTGGGANACTGGTTTTGTNNTTC
Sequence Type genomic DNA
Unitrap ID UNI18499

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122903453..122903667 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]


Sequence tag IST14751D7HMF1
Sequence
AGCACTTTATTACGATAAATGCACACAATACTTGTATTGCACCAACATCTGTCTACTGCTTCTGACTTCATTAAATAAGT
TACAATAATACAGTGTGGAACAGCTGGCTGCACACCTAAACAACTGAAGTTAGGACTGGAGGCCTATGTTGTAACCATTC
AGCAGCTGTAGTGTTTTAAATGAATTTATAAATAAGCAAACTGTACAGGGCCCATTAGAAAGCATGTTTCAATGTCACTG
TAGAGCAATCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122903663..122903915 253
 
EST/CDNA Est Name
  AW490860.1 - BM123394.2 - BM124907.2 - CD541887.1 - R75458.1 - BM878404.1 - AI849708.1 - BP757767.1 - BX639662.1 - AW822356.1 - BP761881.1 - AI642395.1 - AI838108.1 - BM125139.1 - CD546498.1 - BM123256.2 - BM123976.2 - BM122637.2 - BM124654.2 - AA144343.1

 
Come back to gene AW490860.1 - BM123394.2 - BM124907.2 - CD541887.1 - R75458.1 - BM878404.1 - AI849708.1 - BP757767.1 - BX639662.1 - AW822356.1 - BP761881.1 - AI642395.1 - AI838108.1 - BM125139.1 - CD546498.1 - BM123256.2 - BM123976.2 - BM122637.2 - BM124654.2 - AA144343.1


For any suggestions or comments, please send an email to unitrap@crg.es