Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14249H2
Clone ID IST14249H2
Vector VICTR74
Project tigm

Sequence tag IST14249H2BBF1
Sequence
AATGCCACTATCTCTTTCTACCTTCCTTTTTGAAATGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124024619..124024661 43
NO GENE  


Sequence tag IST14249H2HMF1
Sequence
AATGCCACTATCTCTTTCTACCTTCCTTTTTGAAATGAGATCTCTCGCTGACCCCAGAGCTCAATAATGAGGCTGAGGAG
AGGGAATAACAGGAGCCAATTGCTTAGAGAAAGAAATTAGGTGACCCTAGGGTATCTTGAATGAGGAAATAGAGCCACAT
GAGATGCATTCAGAGCAGCCTGAAGGCTTGTGGCTATGACATGGCGTCAGATGTTACCCAGTGAGCGAAGCCTTTTTGCT
CTTTAGTATTTGAATAACTGTTTCTTAGGATCGTGCCTGGCTTTCTTTTCTGGAATGCCCATTCTAGTGGGTGTGAGGAA
ACTACCAAGTGGGTCTTTGGGGAAGGAAGGCTCCCAGCCTCTCTAAGCTCCTCTTGTAAAGTGGGGATGGATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124024619..124025015 397
NO GENE  


Sequence tag IST14249H2HMR1
Sequence
NNNAAAGATAANGNTTTCTGACTTTTGCTATATTTAAAACCAACTAATTTATAATGTGTCATATGATAAAAATTATTCGT
TATTGTATTTATTAGGAATATCTCAATTGCTGAACATGTAATAGTTTCAGAGACTACATATATGTCTCCATGGTTGATCA
CTTGCTTGACTCTGCACACCCTGGCTCANTCTCTAGCATCAAANAANCCTTGCTACCCAAAGTATTTTGGAAATACCTTA
TTGCTGATCNNTTCTGTACCCTATGACTTCNNTCC
Sequence Type genomic DNA
Unitrap ID UNI32100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71163843..71164109 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es