Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST439800
Clone ID OST439800
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST439800
Sequence
CAGGCAAGCTCTCTCCTCGGACCTCCATAGGCAGCAAAGGAACCAGGCCCATTCCCCGGGACCATGGTTGGACTTCAGNC
CTCCGAAGCGCCTCCCACAANGGNTGTGAAGTTCCTGGGGGCCGGCACTGCGGACTGTTTTGCGGACCTCCTCACTTTTC
CCCTGGACACCGNCAAGGTCCGTCTGCAGATCCAAGGGGAGAACCCNGGGGCTCAGAGCGTGCAGTACCGCGGTGTGCTG
GGTACCATCCTGACTATGGTGCGCACAGAGGGTCCCCGCAGCCCCTACAGCGGACTGGTCGCTGGCCTGCACCGNCAGAT
GAGTCTTGCCTTCATTNNAATTGGCCTCTACGACTCTGTCCAGCNANTNCTACACCCCCAAGGGAGCGGACCACT
Sequence Type mRNA
Unitrap ID UNI17602

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107627913..107628796 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032942 (Ucp3) NM_009464 uncoupling protein 3 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp3-001]

 
Come back to gene ENSMUSG00000032942


For any suggestions or comments, please send an email to unitrap@crg.es