Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14198A3
Clone ID IST14198A3
Vector VICTR74
Project tigm

Sequence tag IST14198A3BBF1
Sequence
ACTGTGCTTATAAATCCAAGCTGGATGTCTTCACAAATTGGCATATACATACACATATTATACACCAAAGAAAAGTTGCA
TATATTCCCTGAAAACAATATTCCTTGGCAAGTCTATCAAAGTGACTAACAAACTTCATTTTTACTGTGTTCAAGTTACA
CAAACACCTAAGGAGAACACACAAAGTAACTCAATTTTAATCCTTTAAAAAGAGGGTTTTCTTTGATTACATTGATCTCC
ACATTTATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30673501..30673753 253
NO GENE  


Sequence tag IST14198A3HMR1
Sequence
CCCCAAAGAATTAGTTATGCAAAACACTCATATATAAATCTTTAAAAAACTTTTTAGAGTAGTTATCTTTGTTTAGAAGC
CNTCCAGTGAATTCCAGC
Sequence Type genomic DNA
Unitrap ID UNI32011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35507826..35507922 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es