Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11915D11
Clone ID IST11915D11
Vector VICTR76
Project tigm

Sequence tag IST11915D11HMF2
Sequence
CAATCAAGGAATACACAANNNNNNAAGAAAATAAAACTCGCCAGGCGGNGGNGGNGCACACCTTTAATCCCAGAACNNGN
NAGGCANAGGCAGGCGAATNNCTGGGNNNGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAN
ANAAACCCTGTCTCGAAAAAAACAAACAAACAAACAAAAAACAAAACAAAAAACAAAAAAACAAAACAAANNNNNAAAAT
AAAACTCAGCCCCCCCATGCACTGGGTATGGCTCTCCCTAACATCTTTTANTATAAAGGANAGTGACCCATTTTAGGGAG
TATCCTTGGTGAANGTGATNGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11915D11BBF1
Sequence
ANTCAAGGAATACACAAAAGTCTAAGAAAATAAAACTCGCCAGGCGGTGGTGGTGCACACCTTTAATCCCAGAACTTGAG
AGGCANAGGCAGGCGAATTTCTGGGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACANA
NAAACCCTGTCTCGAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI23753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30019342..30019521 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]

 
Come back to gene ENSMUSG00000043557


For any suggestions or comments, please send an email to unitrap@crg.es