Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12740C9
Clone ID IST12740C9
Vector VICTR76
Project tigm

Sequence tag IST12740C9HMF1
Sequence
CNAGGACTTTATTTATTTATTTATTTANAGACAGGGTTTCTCTGTATANCCCTGGCTGTNCTGNAACTNACTTTGTANAT
NAGGCTGTANATNATGANAAATCTACCTGCCTCTGGGTAGGACTCATTCTTAATAGCTTGTGATTATTTTGGAAAATGGC
CCCTANTTTCTTCTTGCTTCTTTTTCTTTGTGANNGTTNCCATGCGATCATCCTTGGTTTTANTCNNCTTATATTTCTTG
GTTTCTTGGGGTCTTTGGGGTCAGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12740C9BBF1
Sequence
CTAGGACTTTATTTATTTATTTATTTAGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGAT
G
Sequence Type genomic DNA
Unitrap ID UNI21290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181021281..181021361 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038705 (Gmeb2) NM_198169 glucocorticoid modulatory element binding protein 2 Gene [Source:MGI (curated);Acc:Gmeb2-001]

 
Come back to gene ENSMUSG00000038705


For any suggestions or comments, please send an email to unitrap@crg.es