Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST439732
Clone ID OST439732
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST439732
Sequence
TAAGGCCCTGGTTCTCTCCNTGAACTGTCCTGCACCATGAACACCAACAAGCTGGAAGAAAATAGTCCTGANGAAGATNC
AGGGAAATTCGAGTGGAAACCCAAGGTCAAAGATGAATTCAAAGACATTTCCATATACTTCTCCAAAGAAGAATGGGCAG
AGATGGGAGAGTGGGAGAAAATTCGCTATAGAAATGTGAAAAGGAACTATAAAATGCTGATTACAATNGGGGTNAGAGCC
CCTAGACCAGCTTTCATGTGTNACCAAAGGCACAGCANTGAANCCCCTANTAAATNACNGNGAGGATNCTGANGAATAGT
GGACNCCTANNCAACAAAGTCAGNNCTTCTTGGGTGCCTTTCCG
Sequence Type mRNA
Unitrap ID UNI17605

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15696012..15700290 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051977 (Prdm9) PR domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2384854]

 
Come back to gene ENSMUSG00000051977


For any suggestions or comments, please send an email to unitrap@crg.es