Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11026H4
Clone ID IST11026H4
Vector VICTR76
Project tigm

Sequence tag IST11026H4HMF1
Sequence
GAACTTCAGACATGGTAAGTACAAAATCATCTCCCATAAAGCCTGGGGAGCAAGCTTCTTAGCAAAGAATGACTGTGTGG
TAGGTCTTTTCCAGCGCATGGATGGTAAGCGTCAGCCAGGCATAGGGGGCCATCTGTGTGCTGCTTTGTGGACCTAGTCT
CTCCTTGGACCCGGCTGTAGCCTATGAATAAATTTATTAACTGGCAGCATCTGGACAAAACCTTTGTGGCAGGGGTTTGT
GTGTGGAAATATACTTGGCAGGATGAGAACCAGAGGAACAGCTTACTGTGTACACTGTCAGGTAAACCAGTGCAGACAAG
AGCTAGGTCACAGACCAAAGGAAAAGGGAGTGTGCTGCAGGGGTCACTGTTATGGAGAANGACCTGATTCAGGCAGTGAG
AATGATTTTGTAATTTCATAGACTGTATCCATTTATGGATATAATTTAGTAAACCTAGATTGAAGAGTGTTTTATTTGGG
CAGGTTAGCTTGAGCNNGTGGGTAATGAATTCCCATTTTNNNATCTGTATTATGTAGATTTGTGCNATCCTTGTN

Sequence Type genomic DNA
Unitrap ID UNI2288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177659724..177660277 540
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074529 (C330013J21Rik) RIKEN cDNA C330013J21 gene Gene [Source:MGI Symbol;Acc:MGI:1925953]


Sequence tag IST11026H4BBF1
Sequence
GAACTTCAGACATGGTAAGTACAAAATCATCTCCCATAAAGCCTGGGGAGCAAGCTTCTTAGCAAAGAATGACTGTGTGG
TAGGTCTTTTCCAGCGCATGGATGGTAAGCGTCAGCCAGGCATAGGGGGCCATCTGTGTGCTGCTTTGTGGACCTAGTCT
CTCCTTGGACCCGGCTGTAGCCTATGAATAAATTTATTAACTGGCAGCATCTGGACAAAACCTTTGTGGCAGGGGTTTGT
GTGTGGAAATATACTTGGCAGGATGAGAACCAGAGGAACAGCTTACTGTGTACACTGTCAGGTAAACCAGTGCAGACAAG
AGCTAGGTCACAGACNAAAGGAAAAGGGAGTGTGCTGCAGGGGTCACTGTTATGGAGAANGACCTGATTCAGGCAGTGAG
AATGATTTTGTAATTTCATAGACTGTATCCATTTATGGATATAATTTANTAAACCTAGATTGAAGAGTGTTTTATTTGGG
CAGGTTAGCTTGAGCCNGTGGGTAATGAATTCCCATTTNAGGATCTGNNNTATGTAGN
Sequence Type genomic DNA
Unitrap ID UNI2288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177659741..177660277 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074529 (C330013J21Rik) RIKEN cDNA C330013J21 gene Gene [Source:MGI Symbol;Acc:MGI:1925953]

 
Come back to gene ENSMUSG00000074529


For any suggestions or comments, please send an email to unitrap@crg.es