Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14116E11
Clone ID IST14116E11
Vector VICTR74
Project tigm

Sequence tag IST14116E11HMF1
Sequence
CTTTAATCCCANCACTCNGGAGGCANAANCANGTGGATTTCTGANTTCNAGGCCNNCCNGGTCTACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14116E11HMR1
Sequence
GTCCTCCTTTAATACTATTGTTGTTAGAAGAAACCCTCTAGCGTGCAAACATTCCCCAGACCCTCCTATCCCTTTCCAAA
GTACTTTCCAAATTTTAATCAGGAGTTGATATTCAGACTGAAGGAACAAAGGAATCCACTGTGTTTAAAAGGCGGACAGG
CAGAGAGTCTGACACATGTTGATCTCTAAGGCATTCCAGGAGTTTCTACCTTCCATCATGTCANTAATTTAACTGGATTC
TGGAGGTCGTAAACGAAAAACGGAACGTTAGGTAATTTCACGTTAAAATACTTTGTCGTCGTCGTTGTTGTTTTAATTAA
TGGGTCATTTTANTTGGGGGAAAGTCCGGACATGATTANGTGCNNNANCTTTNANCTCNNTN
Sequence Type genomic DNA
Unitrap ID UNI27121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76372056..76372433 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es