Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10390E5
Clone ID IST10390E5
Vector VICTR76
Project tigm

Sequence tag IST10390E5BBF1
Sequence
CCNGNACTGGGCCANNGGGTGTGCTGGGNNCTGGTGATGGTGAGTGGTCTTGGTTCCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10390E5HMR1
Sequence
AGGGAACCCCAACACACCTGAGAACCTAGACCTANANNNAAAANNNNATCTCATGATGATGGTAGAGGGCATCAAGAAGG
ACTTTAATAAATCACTTAAAGAAATACAGGAGAACACTGCTAAAGAGTTACAAGTCCTTAAAGAAAAACAGGAAAACACA
ATCAAACAGGTAGAAGTCCTTACAGAAAAAGAGGAAAAAACATACAAACAGGTGATGGAAATGAACAAAACCATACTAGA
CCTAAAAAGGGAAGTAGACACAATAAAGAAAACTCAAAGCGAGGCAACACTAGAGATAGAAACCCTAGGAAAGAAATCTG
GAACCATAGATTTGAGCATCAGCAACAGAATACAAGAGATGGAAGAGAGAATCTCAGGTGCAGAAGATTCCATAGAGAAC
ATCGGCACAACAATCAAAGAAAATGGAAAATGCAAAAAGATCCTAACTCAAAATATCCAGGAAATCCAGGACACAATAAG
AAGANCAAACGTACGGATATANGAGTGGATGANAATGAANATTTTCNACTCAANNNCCAGCNAACATCTTCANCAAAATN
NTG
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100264062..100264622 517
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 33101824..33102384 517
 
EST/CDNA Est Name
  BB200611.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 45420126..45420686 517
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52990930..52991490 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51666165..51666725 517
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29504323..29504883 517
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73295923..73296483 517
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 21034497..21035057 517
 
EST/CDNA Est Name
  DV653026.1

 
Come back to gene DV653026.1


For any suggestions or comments, please send an email to unitrap@crg.es