Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14241H2
Clone ID IST14241H2
Vector VICTR74
Project tigm

Sequence tag IST14241H2HMF1
Sequence
ATAGGAGTCACAGCTCCTTTCTCCACCCTCACAGCCNNGACAAAATGGGAACCAAATTCATGGCCCAGTGTTGTAATCCG
ATCAACCTGTGGCCGGAAACTCTTCCCACTAGATAAAGGCTAACAAACCATCCCAAGTACTTTTGGTGACACTCCCCAAT
TCCACTTCATAACTAGTTTTGCAACCATTATGAATCGTAATGTTAATATCTGATATGCAGGATATCTGACAGGCCACTCC
CCAAAGGGGTTACAACCTACAGGTTGAGAACCGCTGTTTTAGAAGTTGAAAATACAAATTCCAATGAATAAGTCAAGTGT
AGTGAGTCTTACCTATAGGCCAACATTTGAGAAGCCGGGTTAAGCAGACGCCTCGAGTTCTGGGCTATGCTGTAAATTCC
ACAGCAGCCGGAGCTACAGAGTGGGACCCAGTCTCAACTTGCTGGATATCTTGAANGAAAGTCATGGGATTCCATTTCCT
CTTTCTGAATGGAGATGCTAATGCCACTGANTCCCTACTGGAGGGCTGANCNNNANTGCTCCGGAANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53946929..53947474 528
 
EST/CDNA Est Name
  CD769921.1


Sequence tag IST14241H2HMR1
Sequence
TTTTTGGCTTTTTTTCTTTCAATAGATAGGGTTTCTCTGTGTAGCGTTGGCTGTCCTGGTATTTACTCTGTANACCANAC
TGGTGTCAAAAATCACAGCGCTCCGCCTGCCTCTGCCTCCCGAGCGCAGGGGTTAGAGGTGTANGCTACCGCGGCTTTTT
TGGAGGGTGTTTCACTTTCTTAAACTGTGAGCANCATACTACTGACCTTGCATGGATCCC
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53947498..53947716 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es