Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14787G5
Clone ID IST14787G5
Vector VICTR76
Project tigm

Sequence tag IST14787G5HMR1
Sequence
ANTGGTACATACTTATAATCCTAGCACTCAAGAGGCTGAATCAAGAGGCTTGCTATTTTTTTAAGGCCAGCCTGGGGTAT
AGAACAAGAAATTGTCTTTGAAAAAAATATAATTTTTTATTATTTTATATAATTTCCATTTAGATGCTGGCTGCCTATCA
NATAGCTATTAAATANAAACTATTATGTATTATTTACCCTCCATATCTGTTATAAAGCCAGGAAACATGGAGTTGAGATT
TATAATAATATGTGCTCANAAAGAAAGAGGTTAAATATGTATTTANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90908494..90908779 278
NO GENE  


Sequence tag IST14787G5BBF2
Sequence
NGCTGGAGCCCTCGTCCCGGCCGGGGAGAGAAGAAGCCTTCNACCCCGTCTTTCAGTCNCTTCCCTCCTCGTTTCTCATC
ACTCCAACCAGGTAGGGGCTGGAAACCGTCTGGGACCAGTTTGCAGGGTCTGGGAAAGTTTTTTTTTTTTCCTTTTTTTT
TTTCC
Sequence Type genomic DNA
Unitrap ID UNI34708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140257476..140257638 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040945 (Rcc2) NM_173867 regulator of chromosome condensation 2 Gene [Source:MGI (curated);Acc:Rcc2-001]


Sequence tag IST14787G5HMF3
Sequence
AATNCAACCCTTGTGGTGATGAATATGTTCATCCCAATTCTTTCAATTGGCAGAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90908816..90908878 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es