Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13762C3
Clone ID IST13762C3
Vector VICTR74
Project tigm

Sequence tag IST13762C3BBF1
Sequence
AAGCAATGAGTAAAACGTATTTGGCTGAACATAAATATGGGAGGGGGGTGGAATGCATGAATGTAAAGAATGCTGGCATA
AGTAGGACCAGTGAGTTGGGTGTGGCAGTGCACCTTGGAGACAGAGCCAGGCGGACCTCTGAGTTCAAGGACAGTCATCA
GGGCTCCACANANAAATCCTGTCCAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109133068..109133265 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es