Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10997C9
Clone ID IST10997C9
Vector VICTR76
Project tigm

Sequence tag IST10997C9HMF1
Sequence
ATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCANAAGAGGACATCAGATCTCATTACGGGTGGTTGTGAGCCA
CCGTGTGGTTGCTGGGATTTGAACTTCGGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCANC
CCTCCC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14261753..14261917 159
NO GENE  


Sequence tag IST10997C9BBF2
Sequence
ATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGACATCAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI31373 UNI31374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6553353..6553410 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 15871240..15871297 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 73776342..73776399 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12786352..12786409 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024694 (Keg1) NM_029550 kidney expressed gene 1 Gene [Source:MGI (curated);Acc:Keg1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138884738..138884795 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30854309..30854366 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058447 (Zfp82) NM_177889 zinc finger protein 82 Gene [Source:MGI Symbol;Acc:MGI:1890753]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124236330..124236387 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88979502..88979559 58
NO GENE  

 
Come back to gene ENSMUSG00000058447


For any suggestions or comments, please send an email to unitrap@crg.es