Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10256B3
Clone ID IST10256B3
Vector VICTR76
Project tigm

Sequence tag IST10256B3HMF1
Sequence
CTCACAGGCTAGAACAGATTATTGTAGCCNGATTACAGTTTCTCCAGCAATAGGATTCCTTTAAAAATTCANCAAGCTCA
GTGGTTAAGAGCACTTGTGGCTCTTGCAGAGGACCCAGGTTTGATTTCAAGAACCTACCTGGTTCACAACCATCTGTTAC
TCCAGATCTAGAGATTTGATGCCCTCTTCTGATCTATCCAGACACCAAGAACAGACTTGGTACCGGCACACTGATGTANG
CAAAACCACTCACACATAAAATAAAAATGAGTAACTATTTTTTTTTAAGTCCNCTGNGCCTGGNNCCTTATTTTTATTTT
ATTTNATTTTN
Sequence Type genomic DNA
Unitrap ID UNI30917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35970616..35970945 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]


Sequence tag IST10256B3BBF1
Sequence
CTCACAGGCTANAACAGATTATTGTAGCCAGATTACAGTTTCTCCAGCAATAGGATTCCTTTAAAAATTCANCAAGCTCA
GTGGTTAAGAGCACTTGTGGCTCTTGCAGAGGACCCAGGTTTGATTTCAAGAACCTACCTGGTTCACAACCATCTGTTAC
TCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35970616..35970784 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es