Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14477H6
Clone ID IST14477H6
Vector VICTR74
Project tigm

Sequence tag IST14477H6HMF1
Sequence
ATACAAAATTAATTAAAAAATAATCCCAATTGGTTATCCAATACCCAATAGTCAGCCCTGAAATTTAATATGTACTATAT
GGACTGATCAGATTGTAATAGTGTGTGTGTTTGTGTGTGTGTACTGATCAGATTGTAATAGTGTGTGTGTGTGTGTGTGT
GTGTGTGCGCGCNCGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4896062..4896235 164
NO GENE  


Sequence tag IST14477H6HMR1
Sequence
GTATGTATAGCTGCTAGCCTACATATGCCGTCTATGCACCACATATGCCGTTTCCATAGAGGCTAGAGAAGGACATAGGA
TCC
Sequence Type genomic DNA
Unitrap ID UNI16140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4895983..4896065 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es