Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10983G11
Clone ID IST10983G11
Vector VICTR76
Project tigm

Sequence tag IST10983G11HMF1
Sequence
CCTGGTTCCACAGAGGCCAGAAGAGGGCATCAGATTGCCTGGGACTGTTCCACATGTATGTGAGTGCTTTGAATTGATCC
AGGTTCCCCGGGAAGAACAGCGTATGCTCTTAACCACTGAGCCAACACTCTAGCTCCCTAAATCACTGATGATTAGGATT
TGGATAAAAATTTGACAGAAAGGTTTTCCTTTATTTCCTTAAAGTTTGTGGGAGTTTGGTTTTTGAGTCTGGGTCTCAGT
TAGCCCCGATGCGAGCTCAACCTTGCCATGTAGCNAAGGCTGGTTCTGAACTCCCGATTTTTCAGTCTCTACTTCCCAAG
TGCTGCATCTTCCGGCTTATGTTACTATGCCCTACTTCCNAGTNNTGTATGACCACCAATTTAAGGTAGAAATAGTTNAN
AATANTCCTAAAGAAAGAAAAGTTGCCAGTACATAAAAGATTGAAGTCCCGTTGTTTACNGATGTNATGTGTCCGANACT
AATTCCNAAATAAGCGCATTATACTGGTCGGANNTCGGAAAANGGACTGANAATANTCTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115424844..115425382 507
NO GENE  


Sequence tag IST10983G11HMR1
Sequence
CCNAGACTACCAGCCCTGANATGGTCCCACCCACAAGGGCCTTTCCCCCTTGATCACTAATTGAGAAAATGCCTTACAGT
TGGATCTCATGGAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI35125 UNI36405 UNI36406 UNI36407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 149406517..149406664 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 14382344..14382491 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019868 (Vta1) NM_025418 Vps20-associated 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Vta1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 66308943..66309090 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053930 (Gm879) NM_001034874 gene model 879, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685725]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20670470..20670617 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 43209269..43209416 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27832758..27832905 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040276 (Pacsin1) NM_011861 protein kinase C and casein kinase substrate in neurons 1 Gene [Source:MGI (curated);Acc:Pacsin1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13318342..13318489 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112845410..112845557 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057378 (Ryr3) NP_808320 ryanodine receptor 3 Gene [Source:MGI (curated);Acc:Ryr3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 47603368..47603515 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147005200..147005347 144
 
EST/CDNA Est Name
  CN679893.1 - CD549057.1 - CF164649.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 78423125..78423272 144
NO GENE  

 
Come back to gene CN679893.1 - CD549057.1 - CF164649.1


For any suggestions or comments, please send an email to unitrap@crg.es