Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11081C1
Clone ID IST11081C1
Vector VICTR76
Project tigm

Sequence tag IST11081C1HMF1
Sequence
AGGCTACACAGNNAAACCGGTCTCAAAAACTAAAACAAAAACAAACAAACAAACAAAAAAATGAGATTTTTTTTCAAAAA
ATTTTTTGAATTATTTATTTTTTTTATATGAGTACACTGTGGCTGTCTTCANACATACCANAANAAGGCATTGGATCCCA
TTACAGATGGTTGTGAGCTACCATGTGGTTGTAGGGAATTGAACTCAGGACCTCTGGAANANCAGTCANTGCTCTTAACC
GCGGANCCATCTCTCCAGCCCCCTGGNNATTTTTTTTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI31984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63971040..63971316 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]


Sequence tag IST11081C1BBF1
Sequence
AGGCTACACAGAGAAACCGGTCTCAAAAACTAAAACAAAAACAAACAAACAAACAAAAAAATGAGATTTTTTTTCAAAAA
ATTTTTTGAATTATTTATTTTTTTTATATGANTACACTGTGGCTGTCTTCAAACATACCAGAANAAGGCATTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63971040..63971196 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]

 
Come back to gene ENSMUSG00000032401


For any suggestions or comments, please send an email to unitrap@crg.es