Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10752A6
Clone ID IST10752A6
Vector VICTR76
Project tigm

Sequence tag IST10752A6BBF1
Sequence
GGACGACAGATGAGCAGGAGAAAGCTTCTCTAGTGCAGTGTGTGCAGGTAAAAATGTTCACGGAGAATCTTCTGGAAGGA
GTGATGTTTCCCCAGCCCACCAACAGCATGTCTCGGCACCCTCAACATATATGACCCCAAATTAGAGGTATCGTTCTCCT
TTAGTGATTGCAAGAAAATGGCAGAGAAATCAGGTAACGCAGCAGCAGTGTTCCGTGTGCTTTGGTAGAGGCTGATCCAC
AGTTTTACTAGTTTACTCACTCATCCTGCATCTGCTTTTCTGCAGAGAAAGTTTAGTGGTCGGTAACGGCCCTTGTTCCT
TAGTTCCACTCTCACCTTCAGGGCTCTGCATTCTGAGCCTAGTTCTGATATCACATCTGGCTGANGCACAGCCNGTTATG
GCATTCATTATCCTGGCAGANGAAAACCTGGAGTCTTGGGATAGAGGTGGAGACAAATGACNNTCTGAAAGAAAACTCTA
GAAAATTTGTATGCCNAAATGCTGGTAANTTNAGCCTTCGGACAAGTNNAATAGCAGCN
Sequence Type genomic DNA
Unitrap ID UNI6372

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20138708..20139245 518
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]


Sequence tag IST10752A6HMF1
Sequence
GGACGACAGATGAGCAGGAGAAAGCTTCTCTAGTGCAGTGTGTGCAGGTAAAAATGTTCACGGAGAATCTTCTGGAAGGA
GTGATGTTTCCCCAGCCCACCAACAGCATGTCTCGGCACCCTCAACATATATGACCCCAAATTAGAGGTATCGTTCTCCT
TTAGTGATTGNNNNAAAATGGCAGAGAAATCAGGTAACGCAGCAGCAGTGTTCCGTGTGCTTTGGTANAGGCTGATCCNC
AGTTTTACTAGTTTANNNNNTCATCCNGCATCTGCTTTTNNGCNNAGAAAA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es