Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12818E7
Clone ID IST12818E7
Vector VICTR76
Project tigm

Sequence tag IST12818E7BBF1
Sequence
GTATATATGGGTATACTTCCTGAATGTCTCTGTACACTATGTGTGTCCCTGGTACCTGCAGAGGCCTGAAGCGGGCATCA
NAGCTCCTGGGACCGGAGTTACAGATGGTTGTGAGCTGCAACATAGGTGCTTAGAATTGAACCCAGCTTTTCTAGAAAAG
CAGCCAATGCTCTTAACTGCTGAGCCATCTCTCCATCCCCAAGGCCAGAATTCTTGATCACAAGAACAACAACATCTTTA
GAAATTACATCAGGCTTTGTTGGACAATTATCCCATTTTTGTGTAATCTCANAAGTCAAGCCAAAGTGTCCTGCTACCTC
CATGGAGGGTACCTCTGTGAATAGAATCCCTTCTGCTCCCAGTAAAACAGGTTTGCCAGCTTCGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTNTN
Sequence Type genomic DNA
Unitrap ID UNI27157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152596806..152597224 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


Sequence tag IST12818E7HMR1
Sequence
NNCAAAATANTAATAAAAANNNNNNNANTTGTGGCCTTTTTCTTGTTGGACTAACAGGTGGTGACTTAACTCANGAACTG
TCCAGCCCCTCCGATGGATGGCTACAGTTAGGAATCTGAGGTTCTGCTCTGAGCCTTGTGATAAGGCGGAGGAACTAACT
GTAGCCGCCTAGATGCCAAGAAAGCCCAAGGTTACCAAGAGCAGGCTAGAAGACCTGCCCTCGCTCCAGTGAGCACAGCA
GCAGGTCAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152597224..152597472 228
NO GENE  


Sequence tag IST12818E7HMF1
Sequence
GTATATATGGGTATACTTCCTGAATGTCTCTGTACACTATGTGTGTCCCTGGTACCTGCAGAGGCCTGAAGCGGGCATCA
GAGCTCCTGGGACCGGAGTTACAGATGGTTGTGAGA
Sequence Type genomic DNA
Unitrap ID UNI27157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152597110..152597224 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es