Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST439455
Clone ID OST439455
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST439455
Sequence
TGTGGTACTAGATAGGAGAGATGGGAAATGCATTGCTGAACACCCTGTTAACAAAGAGGTCCCTTTGCTGTTGAGAAAGA
AAATGGTACTGTTGGAGCACAAAATGGGACCTGAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCACAGGAAAGCCAACAGAGNCNNCTANCTTGAACCCTTANGGCTCT
CATAGACTGAGCCACCA
Sequence Type mRNA
Unitrap ID UNI17483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 114429140..114439134 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057215 (EG434225) predicted gene, EG434225 Gene [Source:MGI Symbol;Acc:MGI:3645719]

 
Come back to gene ENSMUSG00000057215


For any suggestions or comments, please send an email to unitrap@crg.es