Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12425D11
Clone ID IST12425D11
Vector VICTR76
Project tigm

Sequence tag IST12425D11BBF1
Sequence
CTCTTGTGCTGTGCAGCAGTGGCGCTGTGTGTAAATGCTATGCACTGAGGATACACAAATATGACGTGTACAGGATAATG
CCTCATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTAACAACCCTTTATCTCTTAGTGTTATAAACTCCACTTAAA
ACTGATTAAAGTCTCATTCTTGTAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727313..97727503 185
 
EST/CDNA Est Name
  CB574369.1 - AU254875.1 - AA450527.1 - DV073594.1 - AV248383.1 - AV071666.1 - BB225871.1 - BB457115.1 - AA154784.1 - BB361291.1 - CK373247.1


Sequence tag IST12425D11HMF1
Sequence
CTCTTGTGCTGTGCANCAGTGGCGCTGTGTGTAAATGCTATGCACTGAGGATACACAAATATGACGTGTACAGGATAATG
CCTCATACAAATCANATGTCCATTTGTTACTGTGTTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727381..97727503 115
 
EST/CDNA Est Name
  AA450527.1 - DV073594.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897630..32897752 115
 
EST/CDNA Est Name
  DV073594.1 - AA450527.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66347568..66347690 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es