Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10911H5
Clone ID IST10911H5
Vector VICTR76
Project tigm

Sequence tag IST10911H5BBF1
Sequence
ACACANTTCGGTGACCTGGAGGTCAGGGACTCTCAAANANCANAGTCCGTCAGGAGATCGGAGCGGGAAGACCCGGAAAA
GGCGTGGTCANAAACAGGGCGGGTTTACTGCGCCCCAAACCGGAANACCCGGATTGGGAAGCGACGAGGCGGGACGGATT
TTANCCNGGTGGGCGTGGCCACTGCGGTGCGGTTTGGGGGCGGGGCCTATANGAACCTGGGGCCCAGCTGGCAGGAGAGG
AGGTTTGGGAACCGGGGCCCGGGGCTGCAGGATCN

Sequence Type genomic DNA
Unitrap ID UNI34123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138041864..138042137 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]


Sequence tag IST10911H5HMF1
Sequence
ACACAATTCGGTGACCTGGAGGTCAGGGACTCTCAAAGAGCAGAGTCCGTCAGGAGATCGGAGCGGGAAGACCCGGAAAA
GGCGTGGTCAGAAACAGGGCGGGTTTACTGCGCCCCAAACCGGAAGACCCGGATTGGGAAGCGACGAGGCGGGACGGATT
TTANCCAGGTGGGCGTGGA
Sequence Type genomic DNA
Unitrap ID UNI34123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138041960..138042137 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]

 
Come back to gene ENSMUSG00000037221


For any suggestions or comments, please send an email to unitrap@crg.es