Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14497F5
Clone ID IST14497F5
Vector VICTR74
Project tigm

Sequence tag IST14497F5BBF1
Sequence
CTACCACTCGTCGCTCCNNTNCCGGCGTGTTTCCCGGGACCGGACTTTCAGCCCCGATGCCGCGAAAACAAAACAATACT
TCTCTCGCGGACAGTCCATAGGGCGCCCGCCAGGCCTGAGCTCCAAGGCCGCTCCACACAGTCCTGCTCAGCACCCGGAG
CCGCGAGCCCCACAGGAAGCGCCGGGATAGCCCCGAGGGCCCCGGAAGGCCGGGGAGCCGCATGACCTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154262506..154262739 228
NO GENE  


Sequence tag IST14497F5HMR1
Sequence
NNNNGTTGGAGGATGCCGGGCTGATATTCCGGAGGGCCCTGTTGAATGTANCTCTGGGGTCGGACTGCTTTGGGTTCATG
TCCTGGCTCCCTCGCGAGTAGGCTGTGACCTTGGCGCTCCAAAAGTCTCAGTTGCTCGATCTGAAAAATGGGTTGTGAGG
AACNTACTCTGAATGCTCTGTANTAN
Sequence Type genomic DNA
Unitrap ID UNI36409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154262742..154262923 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es