Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11245B4
Clone ID IST11245B4
Vector VICTR76
Project tigm

Sequence tag IST11245B4HMF1
Sequence
CCAGGAGTAGCCNGGATGCTCCTGACTCTGCGGTTGTTGCTGAAGTGGGACTCANATTCAGAAGAGATGACAGGAAGGAC
AAAAA
Sequence Type genomic DNA
Unitrap ID UNI12938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100238396..100238479 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]


Sequence tag IST11245B4BBF1
Sequence
CCNNGNNNNCCNNNNNGCTCCTGACTCTGCGGTTGTTGCTGAAGTGGGACTCAAATTCNNAAGAGATGACAGGAAGGACA
AAATACCTAAAGCCGGGGATCAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI12938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100238371..100238462 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es