Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14217G10
Clone ID IST14217G10
Vector VICTR74
Project tigm

Sequence tag IST14217G10HMR1
Sequence
TTAAAACCNAATGAACAAAAAAGGTGACAAGTTATAGATAAAATTTCATTACAAGAACAAAATAGAATGCCAAAGAAAAG
TGAAAAAAGAAATTTAAAAATCTGGATTATGGTGGCACACACCTTAAGTCCCAGCACGAGGGAGGCAGAAGCAGAAGCAG
GCAGATCTCTGTGAGTTTGAGGCCAGCCTGGTCTACAAAGTAAGTTCCAGGACANCCTGGGCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 36663141..36663366 222
NO GENE  


Sequence tag IST14217G10BBF1
Sequence
TTAAGACAATGCCTTACTATATAGCTTGGGCTGTCATAGAAATTACCATATAGACTAGGCTGGGCTTGAACTCATAGAGA
TCCACCTGACCCCAGCTGAAGTGTTGGGGTTTTGTTTTGTTGAGAAGGGAGTAAGGGGATCTCACTAATTTGCCAAAGCT
ATCTTCANACTTTACATTTNNNNGTCTTTGGAATTNCNGGCCTGTGCTATCATGTCCTTGGTATTTTTATAGANCATTTC
CCCCAGAGAN
Sequence Type genomic DNA
Unitrap ID UNI23434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 36663363..36663611 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032118 (Fez1) NM_183171 fasciculation and elongation protein zeta 1 (zygin I) Gene [Source:MGI Symbol;Acc:MGI:2670976]

 
Come back to gene ENSMUSG00000032118


For any suggestions or comments, please send an email to unitrap@crg.es