Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10381D3
Clone ID IST10381D3
Vector VICTR76
Project tigm

Sequence tag IST10381D3BBF1
Sequence
CTGCGCGTGGCAGGAAGGGTGGTGCTGGGTCCTGTGCATTTCTGCTAGGCAAACCCGATCCCGTGCGACTTGTCTGGTAT
GACCAGAGGCCCCTTCCTGGCCAAGGGCGGCTGAATCCCAGCGGTTCCCAGCGCGGGGCAGAGGAGGAGGGCATGGGGGT
GGAGTTGGGGTGGAGGCAAGATCCGGAAGCAGGCCTCTATCAGTGCACACTCCGACAAGCCTCTTCTTAGGAACTGAACC
TGATTTTTTACGACGCCTGTCCTANTTTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 73183377..73183651 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019718 (2810055F11Rik) NM_026038 RIKEN cDNA 2810055F11 gene Gene [Source:MGI Symbol;Acc:MGI:1914467]

 
Come back to gene ENSMUSG00000019718


For any suggestions or comments, please send an email to unitrap@crg.es