Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14995B12
Clone ID IST14995B12
Vector VICTR78
Project tigm

Sequence tag IST14995B12BBF1
Sequence
GTCAGTTGAAAAGTAAAAGGAGACCACGCATGTCTCCCTCGTGCATCCCCTGCATCTCTTCAGCAGCTCAGACACCGGCA
TCTGGAACAGAACCACTGCCTCTCCGGCCTTAACCACAATACTTGAATTCACGAGGGAGCACAAAGGCTTCGGGGAGCTC
CAGTGATGGAGCCTCACCTGGGGAGAAAGGGATGACATGGACCATTCTTGCCTATACGGCTTGGCTTGTCTATTTAGGGT
GGGGCATCTGCTGGACGGTAGAGCAGCAGGACCGATCGGCTGTAACACCTGCCTTTGCACCCCANCCCCCCCAAAGCTNN
NNNNNCGTCACTAATTACTTAACTTCCATTACCCAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135230245..135230604 344
NO GENE  


Sequence tag IST14995B12HMF2
Sequence
GACAAAGAACTCTTCAGCCCAACCAACTACCACTTCCTGTCCTCCCTGAANGACNCTAAAGGGCTGCTCN
Sequence Type genomic DNA
Unitrap ID UNI29884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135230602..135230670 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es