Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14588G8
Clone ID IST14588G8
Vector VICTR74
Project tigm

Sequence tag IST14588G8BBF1
Sequence
CTATGCACTGAGGATACACAAATATGACGTGTACAGGATAATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTT
GTTAACAACCCTTTATCTCTTAGTGTTATAAACTCCACTTAAAACTGATTAAAGTCTCATTCTTGTAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727313..97727466 150
 
EST/CDNA Est Name
  AA450527.1 - DV073594.1 - AV248383.1 - AV071666.1


Sequence tag IST14588G8HMR1
Sequence
TGCTGCNCANCACANGAGTATCTGAAGAGGCTGAATGGGGGTAAGGCTGTTTTACAGACTGGATGGTTTTANTATATATA
TTCTATATGAAAACAGATCGAACTTTTGAGCTGGCAGGTANAAGGCANCTCTGCCNAATACTANAGTAAAAGCCCCCCAT
TTANTGCNCANATCCNCCCCTTCCGTCTGCATGCNCNACACATTAACAGTATTTAAAGGTAAACGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14588G8HMF1
Sequence
CTATGCACTGAGGATACACAAATATGACGTGTACAGGATAATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTT
GTTC
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727384..97727466 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897667..32897749 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66347605..66347687 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es