Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0393
Clone ID XP0393
Vector pGT0lxf
Project sanger

Sequence tag XP0393
Sequence
CTTTGGAAGCCCTGGAAAGCTGCTTTGCTGTTGGCCCAATCATTGAGAAG
Sequence Type mRNA
Unitrap ID UNI3385

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138989549..138989598 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es