Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12503C8
Clone ID IST12503C8
Vector VICTR76
Project tigm

Sequence tag IST12503C8HMF1
Sequence
AACCGACGCATGAAACACAAGCGGCAGACGCAGCATCGAGAGCCGCCCGAGGGAGAACCAGGCGGGCCGAGCGCCCAGGA
CGACGCGGGAGAGCCAGCCGAGGAACG
Sequence Type genomic DNA
Unitrap ID UNI34197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96214449..96214554 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075588 (Hoxb2) NM_134032 homeo box B2 Gene [Source:MGI (curated);Acc:Hoxb2-001]

 
Come back to gene ENSMUSG00000075588


For any suggestions or comments, please send an email to unitrap@crg.es