Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11062G7
Clone ID IST11062G7
Vector VICTR76
Project tigm

Sequence tag IST11062G7BBF1
Sequence
ACCCTTCCAAAACATACACACACACTTTAATGCATTTCTCAAGCTTGGGCCTTGGGACTACCCCTAGCTTCACCTTCCTT
AGTGTCCTTCTGCCCCAGACTGGGTAAATGCCCTTCCTAGTCTGGTAGGACTTATTCCCCATGCCCTTCATAAAGGGGCA
GTCTCCTTGGCTAGAGAGAGTCATTTGCTAGGAATGCAGTCCCAGAATGGTTTTGTGTATTGGAGTGGTTGGACTTCAGG
GTTTGGGGATGGTAAGTTCTGCTGTCTGTATGGGTACCAGANAGCAGAAAATTTGAAATCTGGATGCACCAGAACATGTG
TGTGCCAGGGATACCCTAACCCAGTCTAGCCNTGCCCCCTCCCCCAAATGCTCACCCAGGANAACTNAGCTNTCCCCTGC
AGTGGTGTATAGGTGACTNTGAGGTCTACACACACNCNCACACACACACACACACACACACACANAGANANANANANANA
NAGANANAGAGANANAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11062G7HMF1
Sequence
ACCCTTCCAAAACATACACACACACTTTAATGCATTTCTCAAGCTTGGGCCTTGGGACTACCCCTAGCTTCACCTTCCTT
AGTGTCCTTCTGCCCCAGACTGGGTAAATGCCCTTCCTAGTCTGGTAGGACTTATTCCCCATGCCCTTCATAAAGGGGCA
GTCTCCTTGGCTAGAGAGAGTCATTTGCTAGGAATGCAGTCCCAGAATGGTTTTGTGTATTGGAGA

Sequence Type genomic DNA
Unitrap ID UNI16704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97665465..97665689 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031788 (Kifc3) NP_034761 kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]

 
Come back to gene ENSMUSG00000031788


For any suggestions or comments, please send an email to unitrap@crg.es