Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10090E10
Clone ID IST10090E10
Vector VICTR75
Project tigm

Sequence tag IST10090E10HMF1
Sequence
GTGACTTTGTACTTCCTTGTGACTCTTAACTGGTATTTTTGGTATTTTCCAACAACGCCCTTCCCACCTCCTTGAGTTGT
GGTTTTTTCCTTTAAATACCCCCTTACCCAGCTACTCGGGGCGCCACGGTCCTCTACCTCTACCTCTTTTATTCAAGAGC
GCTCTTGAATAAAAATCCTCTTGCAATTTGCAGCANGACCATTTCTCGTTGGTGATTTTGGGGTGTCGCCTCTCCTGAGT
CAGAACGTGGGGGAGTCCTCACGTTGTGAGTCTTTCATTCACAAGCATGTGATGTGGGCTCACTGGGCTTAATTTCTTTT
AAATTTGCTACAGTGGGTGTCACANGGTTGGGATTCTGANTNNTCNNAAGACTGAGTCATAANAGTCACAAGTTCNAGGC
CTGCCTGGGCAANNATGAGACCTGTCTAAAAAACAAAANNGCTGTGGAGCANATTAATGATAGAGCATNNCTCTCATATG
TGCCNNGCCCTAGACTCACATTCTAGTGATTTATAAAATGANTAAAGTAATNNTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23724941..23725478 496
 
EST/CDNA Est Name
  BI100083.1 - BY763435.1 - CD354395.1 - BY716661.1


Sequence tag IST10090E10BBR1
Sequence
TCACAAGTGTCAGGTTATCTCTCAAGACAGTTTCTAAGAGCCCCTAACAATCTAAGAGCCCCTAGCAATAGCACCTTTGC
ATAGTGGGTTCCAGTAGTGGTCAGGGTGGGTCAGGGTGACTTTCTTTGAATGAATACTCTTTGAACCCAGGAAGCGGGTG
GGTGGAGGAAGGAATCTGTTTTATGATTAGCATACCTTGGAGCATTGAGTTTACTACTCTTTCATGAACTTGTGCAGGGA
ACTAGGGTTGCTCCTTTTTGTTGTTAAATTTTAAAGACAATTTCTTGCCACGTAGCCCTAGTTTCTGTGAATTATGTAGC
CCTCTCTGCCTGGCTTCACTTTTTGTACTCCTCTGCCTCAGCCTCCTGATCACTTCTGAGATTATAGGATCAAACCACTG
TTCAGCCACTAGTATTTGCCTTTTGGAATGAAAGATCCAGTCTCAAAAGACTCGATGAGTGATGAGCTGTAGCCAGCAGG
CACAGGATGAATTCCTGCAGACCATTCCGCCCCCAGGAAGTGTTCTCACGCTAAGACTCCACCCCTCTCCTAACACTGCT
ATGACCTGTTCTGGATGGAATGAGAAGCACAGTCACTTTTCTTCCCCCTTAGAGC
Sequence Type genomic DNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23724332..23724944 605
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es