Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14725A10
Clone ID IST14725A10
Vector VICTR76
Project tigm

Sequence tag IST14725A10HMR1
Sequence
NNNNNTACANAANNCNNNGAAGTTTTTTTAACCTTNNNGTTTTAAATGTNNCGNTNNNNCTTCNTGTCTTACANTTCCGC
GTTTTTACTTGANTTAGGAAGACGGCTTGAGCCGGCCAGTGGTGGCACACACCTTTAATCCCNCCACTTGGGAGGCGGAN
GCAGGCGGATTTCTGAGTTCGAGGATAGCCAGGGCTACAGAGTGAGTTCCAGGACAGCCAGGGTTACACANAGAAACCCT
GTCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14725A10HMF1
Sequence
TCTCNCTCCGTAGCCCAGGTTAGTCTTANNCTACNTCTCCTANGCTAAACTNGAATCGATTTTGTTCTNNCCTCCNNANC
NNTGCGATTACNGACTATACTCAAGANATGAGAAGCCCACNCCNTTACATGCTCANCGTTTACACANANAAGAGGCCGAG
TAGCCNCGACTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14725A10BBF2
Sequence
AGCCCAGNTCCCTGCGAGAGAGAGCAGCAAGGACTGANAGCACTTAGAGCTGATGAGTAACCATTTCTCCAGACCCAATT
TGGTTTTGGGGGGTTTGGGTN
Sequence Type genomic DNA
Unitrap ID UNI15694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4652671..4652770 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035390 (Brsk1) NM_001003920 BR serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Brsk1-002]

 
Come back to gene ENSMUSG00000035390


For any suggestions or comments, please send an email to unitrap@crg.es