Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11322C1
Clone ID IST11322C1
Vector VICTR76
Project tigm

Sequence tag IST11322C1BBF1
Sequence
GTCTGAGNTCATATGCAGAAGTCAGAACTGACCTCAATTGTCTTCTTCAATCACCTGCACTTTCCATATATTTGTGTATA
TATGTTTCTATATATGTACATGTGTTCTAGGCACCTGAAGTGGCCAGAANAGGGCATTGCTCTTCTAGTTGCTTTTTTGT
TTGCTTGGTTTTTCNAGACAGGGTTTCTTANTTTGACACTGGCTGTCCTANAACTTGCTCTGCANGCCAAGCTGGCCTCT
AACTCANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27173060..27173311 238
 
EST/CDNA Est Name
  AA874045.1 - DV071379.1 - DV070897.1


Sequence tag IST11322C1HMF1
Sequence
GTCTGAGNTCATATGCAGAAGTCAGAACTGACCTCAATTGTCTTCTTCAATCACCTGCACTTTCCATATATTTGTGTATA
TATGTTTCTATATATGTACATGTGTTCTANGCACCTGAAGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27173060..27173182 119
 
EST/CDNA Est Name
  DV071379.1 - DV070897.1


Sequence tag IST11322C1HMR1
Sequence
AGACATATACATGAACACGGGATATATATACACAGAGACTACACAGAATAACTGAAGAATTTGAAAATTGAATAATTATA
AAAAAAATAAAACCCATTTCACATATGAACAAAGGAGTTAAATAGAAGGAACTATATATCTCCAAAGAAGATTAACAGAT
Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27172904..27173063 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es