Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11389A2
Clone ID IST11389A2
Vector VICTR76
Project tigm

Sequence tag IST11389A2HMF1
Sequence
GTGCACACTCGTACTTTAATAAAAGCTCTANAAAAGATCGATAAGGCCTGCAGGTACCTTTAACTGCTTTGCTACCTAAG
GAATTTATCAGGCAAAGTCACTGTATTGTGCTGTCCTGACCATAACATGCATTCAATGAGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20614455..20614596 140
NO GENE  


Sequence tag IST11389A2BBF1
Sequence
GTGCACACTCGTACTTTAATAAANGCTCTNNAAAAGATCNATAAGGCCTGCAGGTACCTTTAACTGCTTTGCTACCTAAG
GAATTTATCAGGCAAAGTCACTGTATTGTGCTGTCCTGACCATAACATGCATTCAATGAGTTGACTGCCCACCCTGTGCT
CCAGCAAAACAAATAGGACAGACAGGATTNNCTCTTTCAGGCTCTGTGCATGCCCCANCCTTATCGTCTACAATACCCAT
TCTGCTCCTGTANNGACTCTNTGCTTACATAATANNNNACCATGTGGGANGATAATAGTCCATGTCCATGTTCCTCANAA
CAGGNNAACTCANNTCCNTGGTGTGCTGCCATGACTGANAACAACCAAAGTGAANCTGGCTGANCTATGAGTTTANCCAT
CCTCAACTAAATCCTTTANNAATAGAGAACAGCAGANGAAACTTGGANCTGCAGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11389A2HMR1
Sequence
GCACAAAGGTTATTTAGCAGGGACTCATGTTGCCAAGCTTATCTTAGATTTATGGTAAATCTGGAAGCAAAGGTTATGTT
TTCAAGGGAGTGATAGGAAGGGCTTGGGGACAGAAATCCTAGCAACTTGGTCTCTGTCTCAGGTCCCTCACTGCCTACCA
CCTCCAGAGCTGTTCCAGAGGGGCCCACATGATTCANCTGCGTGCATACACTCNTTCTTTNNNNGANCCTGTGGTTN
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20614593..20614829 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es