Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST439230
Clone ID OST439230
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST439230
Sequence
CCCAGGGCAGCCTGCGGCTCATCCTGAACACGAAGCTGTGGGCACAGATGCAGATGGATAAGGCCAGTGAAAAGAGCATC
CGCATCACAGCCACCGACGCTGAGGACCAGGGTGTCAAGGTTTTCCTGATCTCGGCCAGCTCCAAAGACACAGGCCAACT
GTATGCTGCACTGCACCACCGCATCCTGGCTCTGCGTAGCCGGGCTGAACAGGAACAGGAGGCCAAGGCGCCCCCACCTG
AGCCAGGAGCCACCCGGGCCACCGAGGAGGAAGACAGTGATGAGGATGCTGTTCTGGCTCCCTCCGGTGTCACGGGGGCT
GGCACAGGTGATGAAGGAGATGGCCAGGCTCCTGGGAGCACATAGCGGCGGAGCCACTGCACCAGGCTGCTGCTTTGTTG
NCTGTCTGCTGCCCGTNCCTCCCTGCAGGCCGCATCATGGNGGNGNCTATTGCCGNGGTGGCCACAGGCTGGATCCGAGT
GTCCCCTCTGCAGCA
Sequence Type mRNA
Unitrap ID UNI17634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56849520..56850452 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es