Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11384E7
Clone ID IST11384E7
Vector VICTR76
Project tigm

Sequence tag IST11384E7HMF1
Sequence
ACACAATAATAAAAATACAAAAACAGAACAAAGAAAGAATACTAAAAGCTGTNAAGAAAAGTGAGCAGTGGTAGTGCATG
CCTTTAATTCCACTCAGAGGCAGAGGCAGGTGGATCTCTGAGCACAAGACCAGCNTGGTCTACAGAGTGAGTTCTAGAAT
AGAGAAACACTGTCTCAAAACAGCAAAAACAAAAACAAAACAACAACAACAAACAAACAAACAAAACACTGTAAAGGAAA
AAGATCAAGTAACATAAAAGGCANACCCATTANTAGTTTAACACACAACTTCTNNNTGNNNACTNTNNNNTCNNTGTGGG
GCTAGACAGAAAGAGACCACNGATGCCANTCTGGACNANTATTNTNANNNNAACTTTGGAAGGAATAAGAAAAGCATTCC
ACATTAAAACCTAATTTAAATAGTATCTATCTACAAATCANNANGTACAGACNACATTAGANNGAAAACNAGAAGTTAAT
AACCACACCCAAGAAAACATAAGAAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11384E7HMR1
Sequence
TGTCTTAGGAATTTTTTTTGTACCTTGATGGGACCCACTTCTTTAATTTGGAAAGAAGTTCATTCTTTGTTGAAAATATT
TTCTGAGCCATTTTGCTCAATTCCTGTTATTTGTAGATTTGGTCTTTTCATGGTGTCTCANAATTCCTGGACTCTTTTTT
TTTTTTTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI2559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 559049..559219 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068457 (Uty) NM_009484 ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:894810]

 
Come back to gene ENSMUSG00000068457


For any suggestions or comments, please send an email to unitrap@crg.es