Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14517A2
Clone ID IST14517A2
Vector VICTR74
Project tigm

Sequence tag IST14517A2HMR1
Sequence
ANAGATGGTTGTGAGCCACTATGTGCTTGCTGGGAATTGAACTCANGACCTCTGGAANAGCAGTCGGTGAGCTTAACCAC
TGGGCCATCTCTCCAGCCCTATTTGCTTTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88832244..88832351 100
NO GENE  


Sequence tag IST14517A2BBF1
Sequence
CTTGTGTGTCTGAAGACAGCAATGGTGTACTCATATACATAAAATAAATATTAAAAAATACTCAAGTGCCTCGTTTACCT
TTAAATACTGTTAATGTGTCGTGCATGCAGACGGAAGGGGTGGATCTGTGCACTAAATGGGGGGCTTTTACTCTAGTATT
CGGCAGAGTTGCCTTCTACCTGCCAGCTCAAAAGTTCGATCTGTTTTCATATAGAATATATATACTAAAACCATCCAGTC
TGTAAAACAGCCTTACCCCCATTCAGCCTCTTCANATACTCTTGTGCTGTGCANCAGTGGCGCTGTGTGTAAATGCTATG
CACTGAGGATACACAAATATGACGTGTACAGGATAATGCCTCATACAAATCNNATGTCCATTTGTTACTGTGTTTGTTAA
CANCCNTTTATCTCTTANTGTTATAAACTCNNNTTNACACTGANTANAGTCTCATTCNTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14517A2HMF1
Sequence
CTTGTGTGTCTGAAGACAGCAATGGTGTACTCATATACATAAAATAAATATTAAAAAATACTCAAGTGCCTCGTTTACCT
TTAAATACTGTTAATGTGTCGTGCATGCAGACGGAAGGGGTGGATCTGTGCACTAAATGGGGGGCTTTTACTCTAGTATT
CGGCAGAGTTGCCTTCTACCTGCCAGCTCAAAAGTTCGATCTGTTTTCATATAGAATATATATACTAAAACCATCCAGTC
TGTAAAACAGCCTTACCCCCATTCAGCCTCTTCANATACTCTTGTGCTGTGCAGCAGTGGCGCTGTGTGTAAATGCTATG
CACTGAGGATACACAAATATGACGTGTACAGGATAATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66023577..66347687 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es