Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14610B5
Clone ID IST14610B5
Vector VICTR74
Project tigm

Sequence tag IST14610B5HMF1
Sequence
AAGCTATGGGTTCCATCTCCAACACTATAAAACAAAAGGAAAGTAACTGCGAGGGAGGACAAGCAGAGACAGCACAGTAC
AAGTAGGTAGAAATTCCACAGGCAAGGAGTTGAAAGGGCACCAGGAAGCCTGGGCCACCCAGCTGGACGGACTATCACAA
CCATCTCGACTGCCCGAGGACATCCTTCAACTGAGATAACTGAACCCCAGAGGGAGGTGTATGTCACAGCTGAGTCACTA
GGCGTCACGTAGCCCAAGGCTCTGGGAGACAAGATTGCAACTTCCCTAAAACCAACTCTAGTAGCCAACAAAGTATTAAA
TCAAGTAGGAGCTCAACAAGTAAAATAAAATACTTCTGGCATCATCCACTTTATAAAACACACCTTTCTATGTAAGTGTC
TTCCCAAGACAGAACTGCCTCATTCACTGGTAAAAGCTGAGCTGAGACCAGGCACGGCAGCACATGCCTACAGATCTAGC
ACTGANTCTGAAGCTTCNGCACAAATCTGANGTAANCCTGGNNTACAAAGTAAAAGCATGTCTCANANNNCAAAGAANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249082..17249638 537
 
EST/CDNA Est Name
  BY127907.1


Sequence tag IST14610B5BBF1
Sequence
AAGCTATGGGTTCCATCTCCAACACTATAAAACAAAAGGAAAGTAACTGCGAGGGAGGACAAGCAGAGACAGCACAGTAC
ANNNNNGTAGAAATTCCACAGGCAAGGAGTTGAAAGGGCACCAGGAAGCCTGGGCCACCCAGCTGGACGGACTATCACAA
CCATCTCGACTGCCCGAGGACATCCTTCAACTGAGATAACTGAACCCCAGAGGGAGGTGTATGTCACAGCTGAGTCACTA
GGCGTCACGTAGCCCAAGGCTCTGGGAGACAAGATTGCAACTTCCCTAAAACCAACTCTAGTAGCCAACAAAGTATTAAA
TCAAGTAGGAGCTCAACAAGTAAAATAAAATACTTCTGGCATCNTCCACTTTATAAAACACACCTTTCTATGTAAGTGTC
TTCCCAAGACAGANCTGCCTCATTCACTGGTAAAAGCTGAGCTGANACNNNNCACGGCAGCACATGCCTACANANCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249162..17249638 449
 
EST/CDNA Est Name
  BY127907.1


Sequence tag IST14610B5HMR1
Sequence
GCTTCTNNNNGCATGCTAGGCGTGTCCTGTACCAGTGAACTGCACTCCCTANCCTGCAGAGCCCCTTCTCTTTCTCCTTT
TAAAAATACGTGTTTAACCAAT
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249646..17249737 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es