Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14037H8
Clone ID IST14037H8
Vector VICTR74
Project tigm

Sequence tag IST14037H8HMF1
Sequence
CACGTTCTGACTCAGGAGAGGCGACACCCCAAAATCACCAACGAGAAAACGGTCTTGTTGCAAATTGCAAGAGGATTTTT
ATTCAAGAGCGCTCTCGGGCCCACGGTCATACACCACGCAGGGGTAGAGGACTGTGGCGCCCCGAGTAGCTGGGTAAGGG
GGTATTTAAAGGAAGAAACCGAAACTCAAGGAAGTGGGGAGGGCTTTGTTGGAAGATACCAAAGATACCAGTTAAGAGTC
ACAAGGAAGTATAAAGTTACAAGAGTCACAAGGAATACCTGGTAATTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 34164538..34164827 290
NO GENE  


Sequence tag IST14037H8BBF1
Sequence
CGTTCTGACTCAGGAGAGGCGACACCCCAAAATCACCAACGAGAAAACGGTCTTGTTGCAAATTGCANNAGGATTTTTAT
TCAAGAGCGCTCTCGGGCCCACGGTCATACACCACGCAGGGGTAGAGGACTGTGGCGCCCCGAGTAGCTGGGTAAGGGGG
TATTTAAAGGAAGAAACCNAANCTCANGGAAGTGGGGAGGGCTTTGTTGGAAGANACCAAAGATACCANTTAAGANTN
Sequence Type genomic DNA
Unitrap ID UNI28081 UNI31430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 34164591..34164825 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 75960465..75960699 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39073422..39073656 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9592665..9592899 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61826417..61826651 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35938010..35938244 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045083 (Lingo2) NM_175516 leucine rich repeat and Ig domain containing 2 Gene [Source:MGI (curated);Acc:Lingo2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 18573736..18573970 221
NO GENE  

 
Come back to gene ENSMUSG00000045083


For any suggestions or comments, please send an email to unitrap@crg.es