Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11030A1
Clone ID IST11030A1
Vector VICTR76
Project tigm

Sequence tag IST11030A1BBF1
Sequence
CACTGATCAAACTCATTCATTCGCTCACTCATCAACTCATCAGTTCAACAACTGAACATAACTACTCTGTGCCAGGCACT
GAACACGCCACAGAAAGCACTCTGTGATTTCAGCCAGAGTGCCAATCAGGGAAACAGACCGTAGAGGGTCACCACCAGTA
GCACCCACTCAGCCCACACTAAAGCTGGGTCTGGGTCCTTCTCGTGATGAGAGCTGGGCTCAAGATTGCCACACCTGGTC
CTGAATGAGGATCGTCAGGAAGGGAGAAACATGACTTTGCAAGCCTATATGGTTTAAGAGGCAAGCGGANAGTCAGACTC
ATGGTATAAGAACCATCCAGGGCTCCCAATGTGCTTGCTCCCTANGAGTTACCCCGAACTTGACACTGAGANTTCTGGCT
CTGANTCCAGCCCCTACCGGGTCATAGTTAGTTAAGGGGCTGAGACCTAGTGNGGACCTCATACATGGCNNGCAGGACTA
CTTTANAAATCTGGTGTCCCCTCCAGCNNGCTGGGGGTTATGTCCTGGANCACTCTCAC
Sequence Type genomic DNA
Unitrap ID UNI31852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4074641..4075179 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030428 (Ttyh1) NM_021324 tweety homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Ttyh1-005]


Sequence tag IST11030A1HMF1
Sequence
CACTGATCAAACTCATTCATTCGCTCACTCATCAACTCATCAGTTCAACAACTGAACATAACTACTCTGTGCCAGGCACT
GAACACGCCACAGAAAGCACTCTGTGATTTCAGCCAGAGTGCCAATCAGGGAAACAGACCGTAGAGGGTCACCACCAGTA
GCACCCACTCAGCCCACACTAAAGCTGGGTCTGGGTCCTTCTCGTGATGAGAGCTGGGCTCAAGATTGCCACACCTGGTC
CTGAATGAGGATCGTCAGGAAGGGAGAAACATGACTTTGCAAGCCTATATGGTTTAAGAGGCAAGCGGAGAGTCAGACTC
ATGGTATAAGAACCATCCAGGGCTCCCAATGTGCTTGCTCCCTANGAGTTACCCCGAACTTGACACTGAGATTTCTGGCT
CTGAGTCCAGCCCCTACCGGGTCATAGTTNGTTAAGGGGCTGAGACCTAGTGGGGANCTCATACATGGA

Sequence Type genomic DNA
Unitrap ID UNI31852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4074641..4075108 462
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030428 (Ttyh1) NM_021324 tweety homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Ttyh1-005]

 
Come back to gene ENSMUSG00000030428


For any suggestions or comments, please send an email to unitrap@crg.es