Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14221A10
Clone ID IST14221A10
Vector VICTR74
Project tigm

Sequence tag IST14221A10HMF1
Sequence
TTAGGCGAGCCAGGGCTGTTACACAGAGTACCCCTCTGTCTCAAAAAACAAAACAAAAAAACCCATATGGCATGTGGACC
TTCTTTTTCTACAGAAGGATTCTGCTGTGTAGCTCTGACTTGTCCACAGCAATCCTCTCACCTCAGCTTCCAAGTGCTGC
AAATAAGGCATGTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649331..164649505 175
NO GENE  


Sequence tag IST14221A10BBF1
Sequence
TTANGCGACCCANGGCTGTTACACANANTACCCCTCTGTCTCAAAAAACAAAACAAAAAAACCCATATGGCATGTGGACC
TTCTTTTTCTACANAANGATTCTGCTGTGTANCTCTGACTTGTCCACACCAATCCTCTCACCTCANCTTCCAAGTGCTGC
AAATAAGGCATGTGTCAACATTTAATTCTTTTTTAAAAATCATTCTANATATTTGCATGGNCNTNNNGNNNNNAAATTCT
TATAATTCTNACCNACTTTNNCTTTGGNCNNGGTATATACCANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14221A10HMR1
Sequence
NNGAACTCACAGAGATCAGCCTGCTTCTGCCTCCCAAGTGCTAGGATT
Sequence Type genomic DNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649506..164649551 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]

 
Come back to gene ENSMUSG00000017764


For any suggestions or comments, please send an email to unitrap@crg.es